| Primary Identifier | MGI:6156483 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Vps13b |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0923 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CATGGATAATCTGTAACAGC and TGACAGTGCATTGCTATTTA targeting the 5' side and TATGGATTACCTGTATACAG and TGTAACAGTGCAGCTTGCCA targeting the 3' side of a critical exon. This resulted in a 2,348-bp deletion Chr15:35445401 to 35447748 (GRCm38). |
