| Primary Identifier | MGI:5907824 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tssk4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCTACTTGAGGTATCTTAG, TTCGAAGTAGTAAGTAGCAA, GTTGTGAGCAGAGCCCAAAA and TATAAAGTGCTCTCACACAG, which resulted in a 706 bp deletion beginning at Chromosome 14 positive strand position 55,650,630 bp, TCTTAGGGGTATAACTATGA, and ending after CATCCTCTCTCCCTTTTGGG at 55,651,335 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000124550 (exon 2) and 491 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 9 amino acids later. |
