Primary Identifier | MGI:6257704 | Allele Type | Endonuclease-mediated |
Gene | Otof | Inheritance Mode | Not Specified |
Strain of Origin | C57BL/6NTac | Is Recombinase | false |
Is Wild Type | false | Project Collection | IMPC |
molecularNote | This allele from IMPC was generated at CNR Monterotondo by injecting CAS9 RNA, the guide sequence TCATCAAGATCTCGGTGAGTGG, and a donor oligo, which resulted in a Point Mutation allele. |