| Primary Identifier | MGI:6780039 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Dnah10 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 mediated recombination using a single guide RNA (AGATGTGAGGGATGTGCCCAAG) introduced a c.13198G>A in exon 76. The introduced mutation was designed to be homologous to the c.12838G>A identified in a human patient with multiple morphological abnormalities of the sperm flagella (MMAF). Immunostaining indicated reduced levels of expression in testes and spermatozoa from homozygous males. |
