| Primary Identifier | MGI:7431475 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr347 |
| Strain of Origin | (C57BL/6J x CBA)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The super-enhancer in intron 2 of Csf1r was targeted with sgRNAs (targeting GAGTCCCTCAGTGTGTGAGAAGG and CAATGAGTCTGTACTGGAGCAGG) using CRISPR/Cas9 technology, resulting in a ~418 bp deletion including the enhancer. |
