| Primary Identifier | MGI:6151414 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Sis |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCAACTTAGAACATGTATT, CATGTATTGGGCTATCATGG, ATAGCTATCAAGTTCAGGTG and GCCCTAGTCATTGCTACAAA, which resulted in a 366 bp deletion beginning at Chromosome 3 position 72,960,985 bp and ending after 72,961,350 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000496008 (exon 4) and 248 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 5 amino acids later. |
