Primary Identifier | MGI:6336117 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Edem1 |
Strain of Origin | C57BL/6NTac | Is Recombinase | false |
Is Wild Type | false | Project Collection | IMPC |
molecularNote | This allele from IMPC was generated at Korea Mouse Phenotype Consortium by injecting CAS9 RNA and the guide sequence AAATTCATCCGAGTTCCAGAAGG, which resulted in a Indel. |