|  Help  |  About  |  Contact Us

Allele : Trim33<em1(IMPC)Tcp> tripartite motif-containing 33; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6358622 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Trim33
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project TCPR1387 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGTGCCGCAGTGCCTATTTG targeting the 5' side and ATGCAATATATTTAGGCTAG targeting the 3' side of a critical region. This resulted in a 743-bp del Chr3:103311039-103311781; 6-bp indel Chr3:103311016-103311021delAAAAAA, likely a polymorphism independent of Cas9 activity (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele