| Primary Identifier | MGI:6275158 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Adi1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGAACTGGAATTTCCACC and GCGAGGCAGCATTATCTACA, which resulted in a 2357 bp deletion beginning at Chromosome 12 position 28,677,511 bp and ending after 28,679,867 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000107236 and ENSMUSE00000107235 (exons 2 and 3) and 2057 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40, remove 100 amino acids and retain the last 39 amino acids before the stop. In addition there is a 20 bp AGATACTTATGCTGCCTAGC insertion at the deletion site. |
