Primary Identifier | MGI:6149992 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Pmpca |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGTTCTCCTCTCTTCACAG, CAGCTGGTCTAAATGAAGAC, GAAGGGCTATAACTTCCTGT and ATGGCATTCATGCTTACACA, which resulted in a 525 bp deletion beginning at Chromosome 2 position 26,390,877 bp and ending after 26,391,401 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000164354 (exon 5) and 430 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after amino acid residue 145. |