| Primary Identifier | MGI:6316228 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ulk3 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0440 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of ATCAACGAGGCATCCGGATT and TTTGAAGGGGCCGACCCCAT targeting the 5' side and GACTTAACAGAGCGACCCCT and GAGCTGAGCCCGGCGCCAAA targeting the 3' side of exons ENSMUSE00000258949, ENSMUSE00000218586, and ENSMUSE00000258920 (exons 2-4) resulting in a 1,210-bp deletion of Chr9 from 57590273 to 57591482 (GRCm38). |
