| Primary Identifier | MGI:6379319 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Kbtbd13 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTGGCAGTGCGGTGGCCAC and CATCATGCCCCCAGGCCCCG, which resulted in a 1340 bp deletion beginning at Chromosome 9 position 65,390,300 bp and ending after 65,391,639 bp (GRCm38/mm10). This mutation deletes 1340 bp from ENSMUSE00000424249 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and early truncation 11 amino acids later. |
