| Primary Identifier | MGI:7384345 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ankrd60 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGTTGATAAGCAAGCCCGA and GCGTGATTCAGGGCCAGACG, which resulted in a 360 bp deletion beginning at Chromosome 2 position 173,572,334 bp and ending after 173,572,693 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001273680 (exon 2) and 229 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 117 and early truncation 20 amino acids later. |
