Primary Identifier | MGI:6367835 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Tpx2 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTTCTGCAGTAGTCTGACT and GTTTATGGATTGTAGCTTGC, which resulted in a 253 bp deletion beginning at Chromosome 2 position 152,873,064 bp and ending after 152,873,316 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001204719 (exon 5) and 126 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 76 and early truncation 24 amino acids later. There is a 3 bp insertion (AGA) at the deletion site. |