Primary Identifier | MGI:5763013 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Tex2 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele from project Tex2-7559J-M9640 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAGAATAATGACCTAAAGGC, TGAGTGTGCACCTGTTTAAA, TACAGTCAGATCATGACAGA and GGATACATTTCAGAGATGGC, which resulted in a 610 bp deletion spanning exon 4 beginning at Chromosome 11 positive strand position 106,546,571 bp, AGGCCGGCTTCCTGTCTGCC, and ending after TACATTTCAGAGATGGCTGG at 106,547,180 bp (GRCm38/mm10). This mutation deletes exon 4 and 270 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 613 and an early truncation after an additional 15 amino acids. |