Primary Identifier | MGI:6284338 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Uckl1 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, GTAAATGCCTAGGATACACC and CTACCCACCACAGTCCACAT, which resulted in a 1225 bp deletion beginning at Chromosome 2 position 181,574,071 bp and ending after 181,575,295 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001277585 and ENSMUSE00001268540 (exons 2 and 5) and 684 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 39 and early truncation 2 amino acids later. |