| Primary Identifier | MGI:7515017 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nwd1 |
| Inheritance Mode | Not Specified | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTGTAATAGTCACACCATC and ACTTGCGTTTGAGATCACAG, which resulted in a 546 bp deletion beginning at Chromosome 8 position 72,662,018 bp and ending after 72,662,563 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000981978 (exon 4) and 248 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 69 and early truncation 8 amino acids later. There is a 4 bp insertion at the deletion site (TTGA). |
