| Primary Identifier | MGI:6105937 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Retnlb |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Embryos were injected with guide RNA targeting exon 2 and Cas9 nuclease. Sequencing of several mice revealed an animal carrying the deletion of a single adenine nucleotide in this signal peptide coding region (CGTCTCCCTTCTCCCACTGATA -> CGTCTCCCTTCTCCCACTG*TA) which created a frameshift and premature stop codon. |
