| Primary Identifier | MGI:5776370 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cxxc4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Cxxc4-7605J-M4523 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCGGAGGCCCCGGGCTTGC, CGCGTTGTCGCAGTTCCACG, AGATAATGAATCTCCCCGAG and AACACTGCAGACCTTTGGCG, which resulted in a 692 bp deletion in exon 3 beginning at Chromosome 3 positive strand position 134,239,753 bp, CTTGTGGATTACAACTCGGA, and ending after CTTCACTCCCCCGCAGCAGC at 134,240,444 bp (GRCm38/mm10). In addition there is another 19 bp deletion (CCGGAGGCCCCGGGCTTGC) 38 bp before the 692 bp deletion which together result in a total of 711 bp deleted from exon 3. This mutation is predicted to cause a change of amino acid sequence after residue 13 and early truncation 9 amino acids later. |
