| Primary Identifier | MGI:6511815 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Ttn |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using CRISPR/Cas9 technology with an sgRNA (targeting AGCTCTTCCAACGCTGTTGG) and an ssODN template, a C-to-A mutation (c.533C>A) that changes alanine codon 178 to an aspartic acid codon (p.A178D) was created. This mutation mimics a mutation found in a family of autosomal dominant left ventricular non-compaction (LVNC) and familial dilated cardiomyopathy (DCM) patients. Transcript and peptide expression was not affected by this mutation, nor was localisation of the peptide. |
