| Primary Identifier | MGI:6202381 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gm5547 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGACCACCCCATAAGAATT and GACTTGTCTTGCCATTAGTA, which resulted in a 2461 bp deletion beginning at Chromosome 3 position 105,815,236 bp and ending after 105,817,696 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001347726-ENSMUSE00001353780 (exons 1-4) and 1400 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to create a null allele. |
