| Primary Identifier | MGI:7574121 | Allele Type | Endonuclease-mediated |
| Attribute String | Conditional ready, No functional change | Gene | Arid5b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein with guide RNAs having the spacer sequences GCAAGTACTCAAGTCTAGCA and AGCTCAAAGTTGCTACAAAC. A single repair template containing the loxP sites, intervening sequence and flanking homology arms was delivered by incubating embryos with recombinant AAV. This resulting allele has loxP sites flanking exon ENSMUSE00000099312 (GRCm39). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. |
