| Primary Identifier | MGI:6117091 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dnajb5 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCATTTAGTGGCAGAGGGAA, CCTTTCTTATTCTGTCAGCG, ATGTACACGGGAAAAGACCA and ACACGGGAAAAGACCATGGC, which resulted in a 775 bp deletion beginning at Chromosome 4 positive strand position 42,956,466 bp and ending after 42,957,240 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001313254 (exon 3) and 173 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 11 amino acids later. |
