| Primary Identifier | MGI:5004857 | Allele Type | Targeted |
| Attribute String | Conditional ready, Humanized sequence | Gene | Npm1 |
| Transmission | Germline | Strain of Origin | Not Specified |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | A loxP site was inserted into intron 10 and a puromycin resistance gene cassette, a second loxP site and a modified exon 11 into intron 11. The exon modification involves replacing the end of the endogenous coding sequence and start of 3' UTR with the equivalent sequence for the human A variant of NPM1, which has a frameshift and slightly longer translated sequence: mouse sequence GCAGTGGAGGAAATCTCTTTAAGAAAAGG (reverse strand) was replaced with human sequence TCTGGCAGTGGAGGAAGTCTCTTTAAGAAAATA. |
