Primary Identifier | MGI:6156425 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Cyp2d22 |
Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
Is Wild Type | false | Project Collection | IMPC |
molecularNote | This allele from project TCPR0614 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of ACACTAGCAAGGTCATGATG and GAATGCATTACGGGCAAGCC targeting the 5' side and GGCTTTGGACCACGCTCTCA and CTCTGGGACCTAATTGAGGT targeting the 3' side of exon ENSMUSE00000250238 resulting in a 337-bp deletion of Chr15 from 82374298 to 82374634 (GRCm38). |