Primary Identifier | MGI:6257614 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Etv6 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJcl |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele from IMPC was generated at RIKEN BioResource Center by injecting CAS9 Protein and the guide sequence CCCATTGAGAGCAACAAGTTCGA, which resulted in a Indel. |