|  Help  |  About  |  Contact Us

Allele : Cenpb<em1Lamp> centromere protein B; endonuclease-mediated mutation 1, Michael A Lampson
Primary Identifier  MGI:7427843 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cenpb
Strain of Origin  (CF-1 x (DBA/2J x C57BL/6J)F1) Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR-cas9 mediated recombination created a 37 bp deletion (TGAGCACCATCCTGAAGAACAAGCGCGCCATCCTGGC) resulting in a premature stop codon at Leu100 in the DNA binding domain.
  • mutations:
  • Intragenic deletion
Paste the following link
Quick Links:
SummaryGenomePhenotypeOther
 
Quick Links:
SummaryGenomePhenotypeOther
 
Lists
This Allele isn't in any lists. Upload a list.

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele




MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Copyright © 2017 by The Jackson Laboratory. All Rights Reserved

© 2002 - 2017 Department of Genetics, University of Cambridge, Downing Street,
Cambridge CB2 3EH, United Kingdom