| Primary Identifier | MGI:6294044 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Morn3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAAACCTTACAGCTTCAAGG and TTCAGGGCAGAGATTCCCCG, which resulted in a 458 bp deletion beginning at Chromosome 5 position 123,040,862 bp and ending after 123,041,319 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000649828 (exon 2) and 300 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 14 amino acids later. |
