| Primary Identifier | MGI:7408219 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr329 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| description | This mutation occurs with Rr330em2Mam. |
| molecularNote | CRISPR-targeting using sgRNAs (targeting GGCCTAAGACACAGGGCCTTCT and GGCTGCTTGAGTTTCCCAGA) deleted 9 bp (CCCAGAAGG), which includes part of the interferonâactivated sequence (GAS) motif, within the E2 enhancer (part of Wap super enhancer) upstream of Wap. |
