| Primary Identifier | MGI:6272651 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp113 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGGACAGAATTAGAATTT and GGTAGATTGATTCCTAGCCC, which resulted in a 186 bp deletion beginning at Chromosome 5 position 138,151,134 bp and ending after 138,151,319 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001226474 (exon 3) and 94 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 18 and early truncation 5 amino acids later. |
