| Primary Identifier | MGI:6257653 | Allele Type | Endonuclease-mediated |
| Attribute String | Not Specified | Gene | Serpine1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project TCPR1164 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGTAGACGAGCTGACACGCC targeting the 5' side and CTGAGTTCACCACCCCCGAT targeting the 3' side of a critical exon. This resulted in a 863-bp deletion Chr5:137067011 to 137067873; p.(R185Pfs*50). (GRCm38). |
