Primary Identifier | MGI:6430660 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Ccbe1 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences AGGCTGAGCGTGCAAGGTACAGG, CCCATTGCCAGGCCTGCTACAGC, which resulted in a Exon Deletion. |