| Primary Identifier | MGI:6156495 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Hyls1 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0683 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with spacer sequences of GCAGCTAACATTCGTTCTTC and CTTTACTGTAGGGATCATAC targeting the 5' side and ACAACGCACACCCCACCGAA targeting the 3' side of exon ENSMUSE00000701722 resulting in a 685-bp deletion of Chr9 from 35561247 to 35561931 (gRNA_U3 to gRNA_D). This mutation is predicted to cause a frameshift with the amino acid changes after residue 63 and early truncation 38 amino acids later (c.188_872del, p.D63Gfs*40). (GRCm38). |
