Primary Identifier | MGI:6188002 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Psmd13 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by microinjecting Cas9 mRNA and 2 guide sequences TTTAACTCCTGGCTGTGCAG and TCAACATCGTCTGAGCTGTC, which resulted in a 208 bp deletion beginning at Chromosome 7 position 140,883,394 bp and ending after 140,883,601 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001295831 (exon 2) and 129 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 31 and early truncation 13 amino acids later. |