Primary Identifier | MGI:6156441 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Alad |
Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
Is Wild Type | false | Project Collection | IMPC |
molecularNote | This allele from project TCPR0629 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TCCCGTGCCTGGGCAAGCCC and GGGCTATGGATTGATGGCTG targeting the 5' side and AATGTGATCCGGTGCTGAGA and TGCCTGAATTGGGGAGTTCG targeting the 3' side of exons ENSMUSE00001209877 and ENSMUSE00001244921 resulting in a 897-bp deletion of Chr4 from 62512719 to 62513615 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 19 and early truncation 19 amino acids later (p.D19Mfs*21). |