Primary Identifier | MGI:5784893 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Rbm25 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele from project Rbm25-7449J-M3912 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAACATTGATGAACCCAGA, CAGCAAGGCAAAATGATTAA, AGTGTTTTATCTACCCACAG and GTCATTGTAATATGTGCTTG, which resulted in a 340 bp deletion around ENSMUSE00001286618 (exon 6) beginning at Chromosome 12 positive strand position 84,992,175 bp, GCTGTATTTTTTCATGTTTTT, and ending after AATATGTGCTTGTGGCTTAT at 84,992,514 bp (GRCm38/mm10). This mutation deletes exon 6 and 182 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 10 bp deletion (TTTTTTTTTT) and 1bp insertion C in the intron 136 bp before the 340 bp deletion that is not expected to have an effect on the mutation. This exon deletion is predicted to cause a change of amino acid sequence after residue 127 and early truncation 8 amino acids later. |