| Primary Identifier | MGI:6324674 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Heca |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTTGGTGACAAAAGCCCAT and AAGGACACAAGGACTCCAGA, which resulted in an 8090 bp deletion beginning at Chromosome 10 position 17,907,992 bp and ending after 17,916,081 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000320906 and ENSMUSE00000320898 (exons 2 and 3) and 6894 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 92 and early truncation 22 amino acids later. |
