| Primary Identifier | MGI:6406438 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ankrd44 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTGATGGCTGTATCGCGGT and TTCCTGATCTGGGAGTCGGG, which resulted in a 286 bp deletion beginning at Chromosome 1 position 54,763,622 bp and ending after 54,763,907 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001210942 (exon 7) and 143 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 183 and early truncation 1 amino acids later. There is a single base pair insertion (T) at the deletion site. |
