Primary Identifier | MGI:7619043 | Allele Type | Endonuclease-mediated |
Attribute String | Humanized sequence | Gene | Impg2 |
Strain of Origin | C57BL/6J | Is Recombinase | false |
Is Wild Type | false |
molecularNote | Tyrosine codon 250 (TAC) in exon 8 was changed to cysteine (TGC) (p.Y250C) using an sgRNA (equivalent to GATCGCTTCCCCAGAAGTTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of human p.Y254C mutation associated with adult-onset vitelliform macular dystrophy (AVMD) and retinitis pigmentosa (RP). |