| Primary Identifier | MGI:6454667 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Gaa |
| Strain of Origin | C57BL/6NJ | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Guide RNAs (GTACGCTGGTCACTGGACAG and CTGTCCAGTGACCAGCGTAC) are designed to insert an extra adenine at position 1826 (c.1826dupA), resulting in a tyrosine change to a premature stop codon at amino acid 609 (Tyr609*). This mutation results in a truncated protein as seen in patients with Infantile Onset Pompe Disease (IOPD). Silent protospacer adjacent motif (PAM) site mutations (Gaa |
