| Primary Identifier | MGI:6294128 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Trim68 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTCTTTCACTAATGTAAGA and TTTTAGGGTAAGGGTCACGT, which resulted in a 2368 bp deletion beginning at Chromosome 7 position 102,679,556 bp and ending after 102,681,923 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000366315 and ENSMUSE00000401581 (exons 4 and 5) and 2084 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 174 and early truncation 66 amino acids later. |
