| Primary Identifier | MGI:7450836 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cfap100 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCTGGCAGGAACACAGGGG and CTAAAATCAAGATCCAGCAG, which resulted in a 349 bp deletion beginning at Chromosome 6 position 90,412,077 bp and ending after 90,412,425 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001260855 and ENSMUSE00000452276 (exons 10 and 11) and 180 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 308 and early truncation 28 amino acids later. |
