|  Help  |  About  |  Contact Us

Sequence :

Length  106 Residues  tgaacccatcttctatccttgtcctgatccaaacttccccctctgctcgccgctgtcagtctcttggtaaatggcaataaagacgattctctgttggtgtgactaa