|  Help  |  About  |  Contact Us

Sequence :

Length  3259 Residues  aatctatacatggcaaaaatgtatatgaaatccaaggacatggtggagctggtcaacacacaatcctggatggacaaaggtctgagctctcaaaatgagatgaaggagcaagagagaagaccgggctcttatggaatgctcggaaccttaactgaagagcatgacagtattgaggaggatgaagaagaggaagaagatggagataaacctaaaagaagaggtcccaagaaaaagaagatgactaaagctcgccttgaaaggttcagggctcgaagagtcaaggccaatgctagagaacggacccggatgcatggcctaaatgatgccttggataatcttaggagagtcatgccatgttactctaaaactcaaaagctttccaagatagagactcttcgactggcaaggaactacatctgggccttgtctgaagtcctggagactggtcagacacttgaagggaagggatttgtagagatgctatgtaaaggtctctctcaacccacaagcaacctggttgctggatgcctccaactggggcctcaatctaccctcctggagaagcatgaggaaaaatcttcaatttgtgactctactatctctgtccacagcttcaactatcagtctccagggctccccagccctccttatggccatatggaaacacattctctccatctcaagcctcaaccatttaagagtttgggtgactcttttgggagccatcctcctgactgcagtacccccccttatgagggtccactcacaccacccctgagcattagtggcaacttctccttaaagcaagacggctcccctgatttggaaaaatcctacaatttcatgccacattatacctctgcaagtctaagttcagggcatgtgcattcaactccctttcagactggcactccccgctatgatgttcctgtagacctgagctatgattcctactcccaccatagcattggaactcagctcaatacgatcttctctgattagagcaataagataagcaccaacatttcagagaatgaagtggagatgtttttcacatttctagtggctgagctaaactctcagaaaattcaaaagaacctttggatatgcatcaaacataatagtcctagtttgttcagaacttcctgtacctgctaactttcttcccattaacttctcacattggaccagtcctacatttggtaaacttaagtgaatatatttgatggtttgaggccacatggtaatagaacagaaagaaagcccaggccctgttccaatggtgccaaagattaattgaatgctctgccaattaactttccattttcagtgtttttattgctttctgataaacatgaagcaactgttccaaatcaacatatacctttcacctcccacacattttaaaatttaaaagcaatcaaagcaaatagcaaaaatggaatgactatacagaactggaaggagcatcaagtacatatctgttggcttatagaatacaaaatttgtgtgaatttgacaaatcatctttgtgtctacttaaatataacttccagagcctaaaataataacttggatgttaccataaataaccagtatgttctttaagagattagttctacttattactgtgctgaaagatatacacaccttttttagtgattggagaaccatgatagaagcctcacacaaactttattctttatactatttaaaaaacaactgtcttagtactaggagacaagcaagaaagacattgaaatttctcttctggcacacagaaatatcacctagctcatttcttagcttccatgactaaagggctgtggaattttgcaggtattcaggtgcttcagttagaatcagaattcagccaggttcatactgtagagcaataaaatggtggttggctgctatcccaactaacacagttaaaaaactctgcctcacacatagccactggaaaaatgtggatattctccagcaagatgaatttcactgtttaaagcaatgcaattaaagccatagagtttcgtccactccactatcatatattccagaactgttgtaatcaatcttgaattcttacaacataaatgtaactccttacttcccacctaacactgattgttatattgtcttcatttccaagatattatgcaattatatgcaaaattttgattagaatcaaaattaagagtcaatgaatctgtctgtatcttcaggacgggttttgatcagttttaagaaagtttattttcctttatgtggcatctcttttctttgtatccacactggttcagccaagtttctcttctccagagaaattagctctgagaaattttactatcatgatccatcttccacagcaattatttaggttcaactcaagagtatacatagtttatttatagtgggtgaggatacacctccaagaataaattttaacaacattaatgacatatgaatatgccattttatctaccaaactatatatgtatctcttttctttattgcttttatttatttcttcacactgtgagttattttgtgtccatcttattgaagcacttactctgttctactttgcacctttggattataaatatgtttaaaagtctgtaaagacgtcttaaacaactcgtgacagtaattcaacacccctaagaccttgaatcaccctagtggaaataggcaaggagaattatttatagaatcatcctatgtaatttttttgagaatttgctctacctagcatttatgttaatagataattgctatctgcattatttattaggttctatttatttaatttatctttctttctttttatgtaaaaatttgtgccccatagatatagcctcaaagcttcactgggaaactagcttatatgtttggagtgagagaaaaggagaaaatcagttcttgattgcttgcaatggttttataaaacagagcaataatttgaatagatatgcaacttaatggttttagatttttttcctttaaggtgcaacagagttacattattatttatgactttggagaatgtagtacttgtgaaccaggactgtaggcttgtgaagagagattttataattaaatacaaatttagtactgtactatgcttggaaagaacttgttctttaaataatgtttagtcttctgggagtgttttcagataaaatgaagcaattgtttaaaagaaatggctgttttccctcccttttccagtagcaataaagctttgagtgttatt