| Primary Identifier | MGI:7516888 | Allele Type | Endonuclease-mediated |
| Attribute String | Conditional ready, No functional change | Gene | Wdr5 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences TATTGCCCCTCTGCAGTGAA and GTGAGTGAGGTGAGATCCTA and two single-strand oligonucleotides encoding loxP sites. This resulted in loxP sites flanking four exons, ENSMUSE00001206138, ENSMUSE0000016411, ENSMUSE00000164106, and ENSMUSE00000164101 (GRCm39). The loxP sites are inserted after Chr2:27409637 and after Chr2:27411182. Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. |
