Primary Identifier | MGI:6342258 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Otog |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTCACGTACCAAGGAGGGG and TCTTGCTTCCTACTTCCAGT, which resulted in a 520 bp deletion beginning at Chromosome 7 position 46,245,130 bp and ending after 46,245,649 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000204147 (exon 4) and 444 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 34 amino acids later. |