| Primary Identifier | MGI:6163850 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mon2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTAGATGCTCAAAAAACTGG, AGTGTTCAGGCATTCCACCG, GAACTGATTTTATTTCCCAG and GTGTTGTGTGTGCCACTACT, which resulted in a 388 bp deletion beginning at Chromosome 10 position 123,059,114 bp and ending after 123,059,501 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000419243 (exon 2) and 324 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 37 and early truncation 1 amino acid later. |
