Primary Identifier | MGI:6161427 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Ints7 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CAAATACTAACTTATACAGG, TTAAATCTCATATTAAAGTA, TGTCAAATACTAACTTATAC and ATTGTAGGCTTTCTTACAGA, which resulted in a 515 bp deletion beginning at Chromosome 1 position 191,582,302 bp and ending after 191,582,816 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000286639 (exon 2) and 385 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 31 and early truncation 11 amino acids later. |