|  Help  |  About  |  Contact Us

Allele : Prss53<em1(IMPC)Wtsi> serine protease 53; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute

Primary Identifier  MGI:6140219 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Prss53
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and 4 guide sequences GTTCTCGCTTGGCCACATCTAGG, CCAGTCCTGATACCCGTTCTCAT, CGTAACTGCCTGGCCCAGGTTGG, GGCGGAAAAGCAGCTTTTATTGG, which resulted in a Exon Deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories