Primary Identifier | MGI:6356390 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Noc4l |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAAGTACTTTAGAGATGAG and CTATTTAAGATGCCAGACCG, which resulted in a 283 bp deletion beginning at Chromosome 5 position 110,652,269 bp and ending after 110,652,551 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001263903 (exon 3) and 176 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 56 amino acids later. There is a 4 bp deletion (GTGT) 147 bp after the 283 bp deletion. |